AtALMT1-uPIC 5'
(Plasmid
#117886)
-
Purposeprotein expression
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 117886 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepPICZc
- Backbone size w/o insert (bp) 3329
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAtALMT1-uPIC 5'
-
Alt nameALMT1
-
SpeciesA. thaliana (mustard weed)
-
Entrez GeneALMT1 (a.k.a. AT1G08430, ARABIDOPSIS THALIANA ALUMINUM-ACTIVATED MALATE TRANSPORTER 1, ATALMT1, T27G7.11, T27G7_11, aluminum-activated malate transporter 1)
- Promoter AOX
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GACTGGTTCCAATTGACAAGC
- 3′ sequencing primer GCAAATGGCATTCTGACATCC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AtALMT1-uPIC 5' was a gift from Geoffrey Chang (Addgene plasmid # 117886 ; http://n2t.net/addgene:117886 ; RRID:Addgene_117886)