Skip to main content

AtALMT1-upGFP 3'
(Plasmid #117889)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117889 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pPICZc
  • Backbone size w/o insert (bp) 3329
  • Vector type
    Yeast Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Bleocin (Zeocin), 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AtALMT1-upGFP 3'
  • Alt name
    ALMT1
  • Species
    A. thaliana (mustard weed)
  • Entrez Gene
    ALMT1 (a.k.a. AT1G08430, ARABIDOPSIS THALIANA ALUMINUM-ACTIVATED MALATE TRANSPORTER 1, ATALMT1, T27G7.11, T27G7_11, aluminum-activated malate transporter 1)
  • Promoter AOX
  • Tag / Fusion Protein
    • eGFP (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GACTGGTTCCAATTGACAAGC
  • 3′ sequencing primer GCAAATGGCATTCTGACATCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AtALMT1-upGFP 3' was a gift from Geoffrey Chang (Addgene plasmid # 117889 ; http://n2t.net/addgene:117889 ; RRID:Addgene_117889)