-
PurposePeriplasmic expression of superfolder mTurquoise2ox (pNM077 pTHV037-DsbAss-LEGPAGL-sfTq2ox-EFGS-∆1-17-PBP5)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 117960 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepTHV037
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsAdd 0.5% glucose to repress expression
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesfTq2ox-PBP5
-
Alt namepNM077
-
Entrez GenedacA (a.k.a. b0632, ECK0625, pfv)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer GCACTCCCGTTCTGGATAATG
- 3′ sequencing primer TTATCAGACCGCTTCTGCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sfTq2ox-PBP5 was a gift from Tanneke den Blaauwen (Addgene plasmid # 117960 ; http://n2t.net/addgene:117960 ; RRID:Addgene_117960) -
For your References section:
Superfolder mTurquoise2(ox) optimized for the bacterial periplasm allows high efficiency in vivo FRET of cell division antibiotic targets. Meiresonne NY, Consoli E, Mertens LMY, Chertkova AO, Goedhart J, den Blaauwen T. Mol Microbiol. 2019 Apr;111(4):1025-1038. doi: 10.1111/mmi.14206. Epub 2019 Feb 28. 10.1111/mmi.14206 PubMed 30648295