Skip to main content

pET28a-SdrG_N2N3-B1-HIS-ybbr
(Plasmid #117980)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117980 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET28a
  • Backbone manufacturer
    EMD Biosciences
  • Backbone size w/o insert (bp) 5216
  • Total vector size (bp) 6647
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    SdrG_N2N3-B1
  • Alt name
    Staphylococcus epidermidis fibrinogen-binding protein SD-repeat protein G
  • Species
    Staphylococcus epidermidis
  • Insert Size (bp)
    1431
  • GenBank ID
  • Promoter T7
  • Tags / Fusion Proteins
    • H3V 3C (C terminal on insert)
    • HIS (C terminal on insert)
    • ybbr (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer CTAGTTATTGCTCAGCGGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28a-SdrG_N2N3-B1-HIS-ybbr was a gift from Hermann Gaub (Addgene plasmid # 117980 ; http://n2t.net/addgene:117980 ; RRID:Addgene_117980)
  • For your References section:

    Calcium stabilizes the strongest protein fold. Milles LF, Unterauer EM, Nicolaus T, Gaub HE. Nat Commun. 2018 Nov 12;9(1):4764. doi: 10.1038/s41467-018-07145-6. 10.1038/s41467-018-07145-6 PubMed 30420680