Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pET28a-MGGG-ybbr-HIS-SdrG_B1-DK
(Plasmid #117981)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 117981 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET28a
  • Backbone manufacturer
    EMD Biosciences
  • Backbone size w/o insert (bp) 5216
  • Total vector size (bp) 5687
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    SdrG_B1
  • Alt name
    Staphylococcus epidermidis fibrinogen-binding protein SD-repeat protein G
  • Species
    Staphylococcus epidermidis
  • Insert Size (bp)
    471
  • GenBank ID
  • Promoter T7
  • Tags / Fusion Proteins
    • HIS (N terminal on insert)
    • ybbr (N terminal on insert)
    • sortase (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer CTAGTTATTGCTCAGCGGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28a-MGGG-ybbr-HIS-SdrG_B1-DK was a gift from Hermann Gaub (Addgene plasmid # 117981 ; http://n2t.net/addgene:117981 ; RRID:Addgene_117981)
  • For your References section:

    Calcium stabilizes the strongest protein fold. Milles LF, Unterauer EM, Nicolaus T, Gaub HE. Nat Commun. 2018 Nov 12;9(1):4764. doi: 10.1038/s41467-018-07145-6. 10.1038/s41467-018-07145-6 PubMed 30420680