Skip to main content
Addgene

pN_35S/CTP-fluoE
(Plasmid #117992)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117992 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pN_35S
  • Backbone size w/o insert (bp) 9204
  • Total vector size (bp) 11130
  • Modifications to backbone
    pB2GW7 backbone modified to replace bialaphos (BASTA) resistance gene (bar) with a nourseothricin resistance gene
  • Vector type
    Plant Expression, Synthetic Biology ; Plant/bacteria binary vector
  • Selectable markers
    Nourseothricin/streptothricin

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    CTP-CURT_fluoE
  • Species
    A. thaliana (mustard weed), Synthetic
  • Insert Size (bp)
    1203
  • Promoter Cauliflower mosaic virus 35S

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTCGGATTCCATTGCCCAGCTAT
  • 3′ sequencing primer ATATGCTCAACACATGAGCGA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The mCitrine coding sequence was originally obtained from the pET mCitrine LIC cloning vector (a gift from Scott Gradia (Addgene plasmid # 29771)). The mApple coding sequence was originally obtained from the mApple-pBAD expression plasmid (a gift from Michael Davidson & Nathan Shaner & Roger Tsien, Addgene plasmid # 54536)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pN_35S/CTP-fluoE was a gift from Mathias Pribil (Addgene plasmid # 117992 ; http://n2t.net/addgene:117992 ; RRID:Addgene_117992)
  • For your References section:

    Membrane-bound protein scaffolding in diverse hosts using thylakoid protein CURT1A. Behrendorff JBYH, Sandoval-Ibanez OA, Sharma A, Pribil M. ACS Synth Biol. 2019 Mar 18. doi: 10.1021/acssynbio.8b00418. 10.1021/acssynbio.8b00418 PubMed 30884945