pLenti-EGFP-Rabin8
(Plasmid #118072)

• Purpose: Expresses EGFP-Rabin8 in mammalian cells
• Depositing Lab: Ken-Ichi Takemaru
• Publication: pLenti-EGFP-Rabin8 (unpublished)

Backbone

• Vector backbone: pEF1α-IRES-EGFP
• Backbone manufacturer: gift from Dr. Lemischka, Mount Sinai Medical Center, New York, NY
• Backbone size w/o insert (bp): 10000
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: human Rabin8
• Species: H. sapiens (human)
• Entrez Gene: CBY1 (a.k.a. C22orf2, CBY, Chibby1, HS508I15A, PGEA1, PIGEA-14, PIGEA14, arb1)
• Promoter: EF1 alpha
• Tag / Fusion Protein:
  • EGFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Sfi (not destroyed)
• 3′ cloning site: SfiI (not destroyed)
• 5′ sequencing primer: TTCTCAAGCCTCAGACAGTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pLenti-EGFP-hChibby1 (Plasmid #89770) was digested with SfiI, and a PCR-amplified human Rabin8 cDNA was ligated in frame with EGFP.