pMST-712
(Plasmid
#118080)
-
PurposepmbfA::cexA::ttrpC
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 118080 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMST635, pMST1212
-
Backbone manufacturerSarkari et al. 2017
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCexA
-
SpeciesA. niger
-
Insert Size (bp)1575
- Promoter pmbfA
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGGTCACCCCTAGAGACAGTGA
- 3′ sequencing primer TGATGTTGAGGGATTTCGAGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMST-712 was a gift from Michael Sauer (Addgene plasmid # 118080 ; http://n2t.net/addgene:118080 ; RRID:Addgene_118080) -
For your References section:
Engineering of the citrate exporter protein enables high citric acid production in Aspergillus niger. Steiger MG, Rassinger A, Mattanovich D, Sauer M. Metab Eng. 2019 Mar;52:224-231. doi: 10.1016/j.ymben.2018.12.004. Epub 2018 Dec 13. 10.1016/j.ymben.2018.12.004 PubMed 30553933