Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #118223)


Item Catalog # Description Quantity Price (USD)
Plasmid 118223 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 6954
  • Total vector size (bp) 8151
  • Modifications to backbone
    The backbone contains a gut promoter and unc-54 UTR for worm intestine expression of BioID.
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    BioID (BirA mutant)
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
  • Mutation
  • Promoter ges-1p
  • Tag / Fusion Protein
    • 3x HA tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site FseI (unknown if destroyed)
  • 3′ cloning site XmaI (unknown if destroyed)
  • 5′ sequencing primer aagaacgtgatcgcagctctac
  • 3′ sequencing primer cacaatttcattgttagaggtgactt
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    3xHA-BioID_pAS28 was a gift from Jessica Feldman (Addgene plasmid # 118223 ; ; RRID:Addgene_118223)
  • For your References section:

    Efficient proximity labeling in living cells and organisms with TurboID. Branon TC, Bosch JA, Sanchez AD, Udeshi ND, Svinkina T, Carr SA, Feldman JL, Perrimon N, Ting AY. Nat Biotechnol. 2018 Aug 20. pii: nbt.4201. doi: 10.1038/nbt.4201. 10.1038/nbt.4201 PubMed 30125270