N295A (EcN), F103A (EcI) MetNIQ in pBAD
(Plasmid
#118258)
-
PurposeN295A Mutation of MetN and F103A in MetI in Methionine ABC Transporter and Wild Type Methionine Binding Protein for Transport Activity Assay
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 118258 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBAD
-
Backbone manufacturerThermo Scientific Invitrogen
- Backbone size w/o insert (bp) 3963
- Total vector size (bp) 6583
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameMetN (N295A)
-
SpeciesE. coli
-
Insert Size (bp)1032
-
MutationChanged Glutamic Acid (Glu) 295 to Alanine (Ala)
-
GenBank ID944896
-
Entrez GenemetN (a.k.a. b0199, ECK0199, JW0195, abc, metD)
- Promoter araBAD Promoter
-
Tags
/ Fusion Proteins
- 10x HIs Tag (N terminal on insert)
- Enterokinase Cleavage Site (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer pBAD Forward
- 3′ sequencing primer TTAGCAATAATTTGCCCCGGACGCGTGACATA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameMetI (F103A)
-
SpeciesE. coli
-
Insert Size (bp)654
-
MutationChanged Phenylalanine (Phe) 103 to Alanine (Ala)
-
GenBank ID944894
-
Entrez GenemetI (a.k.a. b0198, ECK0198, JW0194, metD, yaeE)
- Promoter None
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer TAGCGCGCAGATGGATTACGCCGGTGGCGTTAAGTTCGGC
- 3′ sequencing primer GCCGACTTTAATGTGGTTTGGATCTTT (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameMetQ
-
Alt nameMethionine Binding Protein
-
SpeciesE. coli
-
Insert Size (bp)813
-
GenBank ID944893
-
Entrez GenemetQ (a.k.a. b0197, ECK0197, metD, yaeC)
- Promoter None
-
Tag
/ Fusion Protein
- 6x His Tag (C terminal on insert)
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer TTTAATTCAGTTCGCAGGCGACCGCATCG
- 3′ sequencing primer pBAD Reverse (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
delta metNIQ E. coli strain BW2115 was a created in the Rees lab by modifying E. coli genomic DNA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
N295A (EcN), F103A (EcI) MetNIQ in pBAD was a gift from Douglas Rees (Addgene plasmid # 118258 ; http://n2t.net/addgene:118258 ; RRID:Addgene_118258) -
For your References section:
Noncanonical role for the binding protein in substrate uptake by the MetNI methionine ATP Binding Cassette (ABC) transporter. Nguyen PT, Lai JY, Lee AT, Kaiser JT, Rees DC. Proc Natl Acad Sci U S A. 2018 Oct 23. pii: 1811003115. doi: 10.1073/pnas.1811003115. 10.1073/pnas.1811003115 PubMed 30352853