Skip to main content

N295A (EcN), E166Q (EcN) MetNI LmH
(Plasmid #118269)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118269 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET19b
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5453
  • Total vector size (bp) 7426
  • Modifications to backbone
    Addd extra T7 Promoter, T7 Terminator, and 6x His Tag with the addition of MetN gene.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    MetI
  • Species
    Escherichia coli
  • Insert Size (bp)
    654
  • GenBank ID
    944894
  • Entrez Gene
    metI (a.k.a. b0198, ECK0198, JW0194, metD, yaeE)
  • Promoter T7 Promoter
  • Tag / Fusion Protein
    • 6x His Tag

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer ccgatcccgcgaaattaatacgactcactataggggaatt
  • 3′ sequencing primer gtggaacactttggtgatattcgaaagttttatcatatga
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    MetN (E166Q ; N295A)
  • Species
    Escherichia coli
  • Insert Size (bp)
    1032
  • Mutation
    Changed Glutamic Acid (Glu) 166 to Glutamine (Gln) and Changed Asparagine (Asn) 295 to Alanine (Ala)
  • GenBank ID
    944896
  • Entrez Gene
    metN (a.k.a. b0199, ECK0199, JW0195, abc, metD)
  • Promoter T7 Promoter
  • Tag / Fusion Protein
    • 6x His Tag (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer tttaattcagttcgcaggcgaccgcatcg
  • 3′ sequencing primer ctcgagtcagacataacccagtacctcta
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    N295A (EcN), E166Q (EcN) MetNI LmH was a gift from Douglas Rees (Addgene plasmid # 118269 ; http://n2t.net/addgene:118269 ; RRID:Addgene_118269)
  • For your References section:

    Noncanonical role for the binding protein in substrate uptake by the MetNI methionine ATP Binding Cassette (ABC) transporter. Nguyen PT, Lai JY, Lee AT, Kaiser JT, Rees DC. Proc Natl Acad Sci U S A. 2018 Oct 23. pii: 1811003115. doi: 10.1073/pnas.1811003115. 10.1073/pnas.1811003115 PubMed 30352853