N295A (EcN), E166Q (EcN) MetNI LmH
(Plasmid
#118269)
-
PurposeN295A and E166Q Mutation of MetN in Methionine ABC Transporter with 6x His Tag. Used to solve crystal structure
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 118269 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET19b
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5453
- Total vector size (bp) 7426
-
Modifications to backboneAddd extra T7 Promoter, T7 Terminator, and 6x His Tag with the addition of MetN gene.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameMetI
-
SpeciesEscherichia coli
-
Insert Size (bp)654
-
GenBank ID944894
-
Entrez GenemetI (a.k.a. b0198, ECK0198, JW0194, metD, yaeE)
- Promoter T7 Promoter
-
Tag
/ Fusion Protein
- 6x His Tag
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer ccgatcccgcgaaattaatacgactcactataggggaatt
- 3′ sequencing primer gtggaacactttggtgatattcgaaagttttatcatatga
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameMetN (E166Q ; N295A)
-
SpeciesEscherichia coli
-
Insert Size (bp)1032
-
MutationChanged Glutamic Acid (Glu) 166 to Glutamine (Gln) and Changed Asparagine (Asn) 295 to Alanine (Ala)
-
GenBank ID944896
-
Entrez GenemetN (a.k.a. b0199, ECK0199, JW0195, abc, metD)
- Promoter T7 Promoter
-
Tag
/ Fusion Protein
- 6x His Tag (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer tttaattcagttcgcaggcgaccgcatcg
- 3′ sequencing primer ctcgagtcagacataacccagtacctcta
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
N295A (EcN), E166Q (EcN) MetNI LmH was a gift from Douglas Rees (Addgene plasmid # 118269 ; http://n2t.net/addgene:118269 ; RRID:Addgene_118269) -
For your References section:
Noncanonical role for the binding protein in substrate uptake by the MetNI methionine ATP Binding Cassette (ABC) transporter. Nguyen PT, Lai JY, Lee AT, Kaiser JT, Rees DC. Proc Natl Acad Sci U S A. 2018 Oct 23. pii: 1811003115. doi: 10.1073/pnas.1811003115. 10.1073/pnas.1811003115 PubMed 30352853