pAAV-Syn-FLEX-Sthk-P2A-bPAC_minWPRE
(Plasmid
#118275)
-
PurposeCre-conditional expression of the SthK channel & bPAC(WT)-mCherry under a synapsin promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 118275 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneCW3SL
-
Backbone manufacturerBong-Kiun Kaang
- Backbone size w/o insert (bp) 3771
- Total vector size (bp) 7407
-
Vector typeAAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namebPAC(WT)
-
Alt namephotoactivated adenylyl cyclase from Beggiatoa sp.
-
SpeciesBeggiatoa sp.
-
Insert Size (bp)1055
-
GenBank ID
- Promoter Synapsin
-
Tags
/ Fusion Proteins
- myc tag (C terminal on insert)
- His tag (C terminal on insert)
- mCherry (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer CGGAGCTACTAACTTCAGCC
- 3′ sequencing primer CGTATCCACATAGCGTAAAAGGAGCAA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameSthK
-
SpeciesSpirochaeta thermophila
-
GenBank IDYP_003873862.1
- Promoter Synapsin
-
Tag
/ Fusion Protein
- P2A (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer GTTCTCCGTTTGCACTCAGGA
- 3′ sequencing primer GGGTTCTCCTCCACGTCTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Syn-FLEX-Sthk-P2A-bPAC_minWPRE was a gift from Dietmar Schmitz (Addgene plasmid # 118275) -
For your References section:
Potassium channel-based optogenetic silencing. Bernal Sierra YA, Rost BR, Pofahl M, Fernandes AM, Kopton RA, Moser S, Holtkamp D, Masala N, Beed P, Tukker JJ, Oldani S, Bonigk W, Kohl P, Baier H, Schneider-Warme F, Hegemann P, Beck H, Seifert R, Schmitz D. Nat Commun. 2018 Nov 5;9(1):4611. doi: 10.1038/s41467-018-07038-8. 10.1038/s41467-018-07038-8 PubMed 30397200