pAAV-EF1a-SwitchON_mRubyNLS-hChR2(H134R)-EYFP-NO_WPRE
(Plasmid #118279)

• Purpose: Expresses mRuby2 in the nucleus of Cre-negative cells, and ChR(H134R)-YFP in Cre-positive cells
• Depositing Lab: Dietmar Schmitz
• Publication: Wozny et al Front Cell Neurosci. 2018 Oct 2;12:337. doi: 10.3389/fncel.2018.00337. eCollection 2018.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 4741
• Total vector size (bp): 7376
• Modifications to backbone: Backbone derived from Addene 20298.
• Vector type: AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: mRuby2
• Species: Synthetic; Entacmaea quadricolor.
• Insert Size (bp): 708
• GenBank ID: AFR60232
• Promoter: EF1 alpha
• Tag / Fusion Protein:
  • SV40 NLS (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: Spe I (not destroyed)
• 3′ cloning site: Nde I (destroyed during cloning)
• 5′ sequencing primer: pEFmyccyto-F (TCTCAAGCCTCAGACAGT)
• 3′ sequencing primer: EGFP_C_F (gaagcgcgatcacatggtc)

Gene/Insert 2

• Gene/Insert name: ChR2(H134R)
• Alt name: channelrhodopsin 2 (H134R)
• Species: Synthetic
• Insert Size (bp): 945
• Promoter: EF1 alpha
• Tag / Fusion Protein:
  • YFP (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: Asc I (not destroyed)
• 3′ cloning site: Nhe I (not destroyed)
• 5′ sequencing primer: EGFP-N1 (acttgtggccgtttacgtc)
• 3′ sequencing primer: CMV5-R (AGAAGGACACCTAGTCAGAC)

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Becaus of the missing WPRE, a high titer virus production (≥ 1×10¹³ vg/mL) is required for efficient gene expression,