pAAV-EF1a-SwitchON_mRubyNLS-hChR2(H134R)-EYFP-NO_WPRE
(Plasmid
#118279)
-
PurposeExpresses mRuby2 in the nucleus of Cre-negative cells, and ChR(H134R)-YFP in Cre-positive cells
-
Depositing Lab
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 118279 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4741
- Total vector size (bp) 7376
-
Modifications to backboneBackbone derived from Addene 20298.
-
Vector typeAAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namemRuby2
-
SpeciesSynthetic; Entacmaea quadricolor.
-
Insert Size (bp)708
-
GenBank IDAFR60232
- Promoter EF1 alpha
-
Tag
/ Fusion Protein
- SV40 NLS (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site Spe I (not destroyed)
- 3′ cloning site Nde I (destroyed during cloning)
- 5′ sequencing primer pEFmyccyto-F (TCTCAAGCCTCAGACAGT)
- 3′ sequencing primer EGFP_C_F (gaagcgcgatcacatggtc)
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameChR2(H134R)
-
Alt namechannelrhodopsin 2 (H134R)
-
SpeciesSynthetic
-
Insert Size (bp)945
- Promoter EF1 alpha
-
Tag
/ Fusion Protein
- YFP (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site Asc I (not destroyed)
- 3′ cloning site Nhe I (not destroyed)
- 5′ sequencing primer EGFP-N1 (acttgtggccgtttacgtc)
- 3′ sequencing primer CMV5-R (AGAAGGACACCTAGTCAGAC)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Becaus of the missing WPRE, a high titer virus production (≥ 1×10¹³ vg/mL) is required for efficient gene expression,
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EF1a-SwitchON_mRubyNLS-hChR2(H134R)-EYFP-NO_WPRE was a gift from Dietmar Schmitz (Addgene plasmid # 118279 ; http://n2t.net/addgene:118279 ; RRID:Addgene_118279) -
For your References section:
VGLUT2 Functions as a Differential Marker for Hippocampal Output Neurons. Wozny C, Beed P, Nitzan N, Possnecker Y, Rost BR, Schmitz D. Front Cell Neurosci. 2018 Oct 2;12:337. doi: 10.3389/fncel.2018.00337. eCollection 2018. 10.3389/fncel.2018.00337 PubMed 30333731