Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-EF1a-SwitchON_mRubyNLS-hChR2(H134R)-EYFP-NO_WPRE
(Plasmid #118279)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 118279 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4741
  • Total vector size (bp) 7376
  • Modifications to backbone
    Backbone derived from Addene 20298.
  • Vector type
    AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    mRuby2
  • Species
    Synthetic; Entacmaea quadricolor.
  • Insert Size (bp)
    708
  • GenBank ID
    AFR60232
  • Promoter EF1 alpha
  • Tag / Fusion Protein
    • SV40 NLS (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site Spe I (not destroyed)
  • 3′ cloning site Nde I (destroyed during cloning)
  • 5′ sequencing primer pEFmyccyto-F (TCTCAAGCCTCAGACAGT)
  • 3′ sequencing primer EGFP_C_F (gaagcgcgatcacatggtc)
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    ChR2(H134R)
  • Alt name
    channelrhodopsin 2 (H134R)
  • Species
    Synthetic
  • Insert Size (bp)
    945
  • Promoter EF1 alpha
  • Tag / Fusion Protein
    • YFP (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site Asc I (not destroyed)
  • 3′ cloning site Nhe I (not destroyed)
  • 5′ sequencing primer EGFP-N1 (acttgtggccgtttacgtc)
  • 3′ sequencing primer CMV5-R (AGAAGGACACCTAGTCAGAC)
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Becaus of the missing WPRE, a high titer virus production (≥ 1×10¹³ vg/mL) is required for efficient gene expression,

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EF1a-SwitchON_mRubyNLS-hChR2(H134R)-EYFP-NO_WPRE was a gift from Dietmar Schmitz (Addgene plasmid # 118279 ; http://n2t.net/addgene:118279 ; RRID:Addgene_118279)
  • For your References section:

    VGLUT2 Functions as a Differential Marker for Hippocampal Output Neurons. Wozny C, Beed P, Nitzan N, Possnecker Y, Rost BR, Schmitz D. Front Cell Neurosci. 2018 Oct 2;12:337. doi: 10.3389/fncel.2018.00337. eCollection 2018. 10.3389/fncel.2018.00337 PubMed 30333731