Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

GFP-ERK2
(Plasmid #118296)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 118296 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ERK2
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    1077
  • Entrez Gene
    Mapk1 (a.k.a. ERK-2, ERT1, Erk2, p42-MAPK)
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer EGFP-C
  • 3′ sequencing primer rev:acctctacaaatgtggtatg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

ERK2 constructs were subcloned into pEGFP-C1 with XhoI and BamHI (GFP-XhoI-ERK-BamHI)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP-ERK2 was a gift from Philip Stork (Addgene plasmid # 118296 ; http://n2t.net/addgene:118296 ; RRID:Addgene_118296)
  • For your References section:

    Examining the mechanism of Erk nuclear translocation using green fluorescent protein. Horgan AM, Stork PJ. Exp Cell Res. 2003 May 1;285(2):208-20. S0014482703000375 [pii] PubMed 12706116