Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

mCherry-Rap2b
(Plasmid #118320)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118320 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    mCherry-C1
  • Backbone manufacturer
    clontech
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rap2b
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    555
  • Entrez Gene
    RAP2B
  • Tag / Fusion Protein
    • mCherry (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site XbaI (unknown if destroyed)
  • 5′ sequencing primer mCherry-C:gcgcctacaacgtcaacatcaag
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

human Rap2b was purchased from the Missouri S&T cDNA resouce center

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mCherry-Rap2b was a gift from Philip Stork (Addgene plasmid # 118320 ; http://n2t.net/addgene:118320 ; RRID:Addgene_118320)
  • For your References section:

    The interaction of Epac1 and Ran promotes Rap1 activation at the nuclear envelope. Liu C, Takahashi M, Li Y, Dillon TJ, Kaech S, Stork PJ. Mol Cell Biol. 2010 Aug;30(16):3956-69. doi: 10.1128/MCB.00242-10. Epub 2010 Jun 14. 10.1128/MCB.00242-10 PubMed 20547757