Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #118320)


Item Catalog # Description Quantity Price (USD)
Plasmid 118320 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
  • Tag / Fusion Protein
    • mCherry (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site XbaI (unknown if destroyed)
  • 5′ sequencing primer mCherry-C:gcgcctacaacgtcaacatcaag
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

human Rap2b was purchased from the Missouri S&T cDNA resouce center

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mCherry-Rap2b was a gift from Philip Stork (Addgene plasmid # 118320 ; ; RRID:Addgene_118320)
  • For your References section:

    The interaction of Epac1 and Ran promotes Rap1 activation at the nuclear envelope. Liu C, Takahashi M, Li Y, Dillon TJ, Kaech S, Stork PJ. Mol Cell Biol. 2010 Aug;30(16):3956-69. doi: 10.1128/MCB.00242-10. Epub 2010 Jun 14. 10.1128/MCB.00242-10 PubMed 20547757