Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCS2+ rat MYO1D
(Plasmid #118419)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 118419 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCS2+
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rat myosin 1D
  • Alt name
    25485
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    3040
  • Entrez Gene
    Myo1d (a.k.a. Myo1c, Myr2, Myr4)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (unknown if destroyed)
  • 3′ cloning site BamH1 (unknown if destroyed)
  • 5′ sequencing primer ccatggcggagcaggagagcct
  • 3′ sequencing primer tcaattcccgggcacactga
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCS2+ rat MYO1D was a gift from Michael Tsang (Addgene plasmid # 118419 ; http://n2t.net/addgene:118419 ; RRID:Addgene_118419)
  • For your References section:

    Vertebrate myosin 1d regulates left-right organizer morphogenesis and laterality. Saydmohammed M, Yagi H, Calderon M, Clark MJ, Feinstein T, Sun M, Stolz DB, Watkins SC, Amack JD, Lo CW, Tsang M. Nat Commun. 2018 Aug 23;9(1):3381. doi: 10.1038/s41467-018-05866-2. 10.1038/s41467-018-05866-2 PubMed 30139971