pCS2+ AMIC
(Plasmid
#118420)
-
PurposeFor mammalian expression of Amoeba myosin 1C
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 118420 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCS2+
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAmoeba myosin 1C
-
SpeciesAcanthamoeba castellanii
-
Insert Size (bp)3562
-
MutationSee depositor comments below
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nco1 (unknown if destroyed)
- 3′ cloning site Xba1 (unknown if destroyed)
- 5′ sequencing primer cggtcaacccctacaaacaaatcaac
- 3′ sequencing primer ttacatgccggggggaggaggacc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note: Plasmid contains a F382I mutation, a G1072-K1073 deletion, and a S1074A mutation in AMIC compared to the NCBI reference sequence AAC98089.1. These differences are not known to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS2+ AMIC was a gift from Michael Tsang (Addgene plasmid # 118420 ; http://n2t.net/addgene:118420 ; RRID:Addgene_118420) -
For your References section:
Vertebrate myosin 1d regulates left-right organizer morphogenesis and laterality. Saydmohammed M, Yagi H, Calderon M, Clark MJ, Feinstein T, Sun M, Stolz DB, Watkins SC, Amack JD, Lo CW, Tsang M. Nat Commun. 2018 Aug 23;9(1):3381. doi: 10.1038/s41467-018-05866-2. 10.1038/s41467-018-05866-2 PubMed 30139971