-
Purposeto overexpress human MALAT1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 118580 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDH
-
Backbone manufacturersystem biosciences
- Backbone size w/o insert (bp) 8247
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin ; copGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMALAT1
-
SpeciesH. sapiens (human)
-
Entrez GeneMALAT1 (a.k.a. HCN, LINC00047, NCRNA00047, NEAT2, PRO2853)
- Promoter MSCV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site gaatGCGGCCGCGTAAAGGACTGGGGCCCCGCAACTG (not destroyed)
- 3′ cloning site CCGCTCGAGTTTTTTTTTCCCCAATCAAGATTTTTTTATTCACAAAAGAAC (not destroyed)
- 5′ sequencing primer cagtttctagcgaaccatcaga
- 3′ sequencing primer GCCTTTGGTGCTCTTCATCTT
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH-hMALAT1 was a gift from Jianjun Zhao (Addgene plasmid # 118580 ; http://n2t.net/addgene:118580 ; RRID:Addgene_118580) -
For your References section:
Targeting the MALAT1/PARP1/LIG3 complex induces DNA damage and apoptosis in multiple myeloma. Hu Y, Lin J, Fang H, Fang J, Li C, Chen W, Liu S, Ondrejka S, Gong Z, Reu F, Maciejewski J, Yi Q, Zhao JJ. Leukemia. 2018 Mar 22. pii: 10.1038/s41375-018-0104-2. doi: 10.1038/s41375-018-0104-2. 10.1038/s41375-018-0104-2 [pii] PubMed 29632340