Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more


(Plasmid #118580)


This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 118580 Standard format: Plasmid sent in bacteria as agar stab 1 $85


  • Vector backbone
  • Backbone manufacturer
    system biosciences
  • Backbone size w/o insert (bp) 8247
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin ; copGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Entrez Gene
    MALAT1 (a.k.a. HCN, LINC00047, NCRNA00047, NEAT2, PRO2853)
  • Promoter MSCV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site gaatGCGGCCGCGTAAAGGACTGGGGCCCCGCAACTG (not destroyed)
  • 5′ sequencing primer cagtttctagcgaaccatcaga
  • 3′ sequencing primer GCCTTTGGTGCTCTTCATCTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDH-hMALAT1 was a gift from Jianjun Zhao (Addgene plasmid # 118580 ; ; RRID:Addgene_118580)
  • For your References section:

    Targeting the MALAT1/PARP1/LIG3 complex induces DNA damage and apoptosis in multiple myeloma. Hu Y, Lin J, Fang H, Fang J, Li C, Chen W, Liu S, Ondrejka S, Gong Z, Reu F, Maciejewski J, Yi Q, Zhao JJ. Leukemia. 2018 Mar 22. pii: 10.1038/s41375-018-0104-2. doi: 10.1038/s41375-018-0104-2. 10.1038/s41375-018-0104-2 [pii] PubMed 29632340