pET27b-ecDHFR-N23PP/L28F
(Plasmid
#118584)
-
PurposeBacterial expression of E.coli DHFR N23PP and L28F mutant
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 118584 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET27b
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5414
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDHFR
-
Alt namedihydrofolate reductase
-
Alt namefolA
-
SpeciesE.coli
-
Insert Size (bp)483
-
MutationL28 mutated to F28, N23 mutated to P23, a proline residue inserted between residues 23 and 24 of wild-type ecDHFR
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET27b-ecDHFR-N23PP/L28F was a gift from Stephen Benkovic (Addgene plasmid # 118584 ; http://n2t.net/addgene:118584 ; RRID:Addgene_118584) -
For your References section:
Functional significance of evolving protein sequence in dihydrofolate reductase from bacteria to humans. Liu CT, Hanoian P, French JB, Pringle TH, Hammes-Schiffer S, Benkovic SJ. Proc Natl Acad Sci U S A. 2013 Jun 18;110(25):10159-64. doi: 10.1073/pnas.1307130110. Epub 2013 Jun 3. 10.1073/pnas.1307130110 PubMed 23733948