pMCh1753_S2F-IMCg_doxy-CMV_mChe-Cdc42E7-E63'UTR
(Plasmid
#118615)
-
Purposeexpression of mChe-tagged cdc42E7-E6-3'UTR (swap) under doxy-inducible CMV promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 118615 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneS2F
- Backbone size w/o insert (bp) 9016
- Total vector size (bp) 11725
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namecdc42E7-E6 3'UTR
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1344
-
GenBank IDNM_009861 NM_001243769
-
Entrez GeneCdc42
- Promoter tetON CMV
-
Tag
/ Fusion Protein
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ACTTGTGGCCGTTTACGTCG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMCh1753_S2F-IMCg_doxy-CMV_mChe-Cdc42E7-E63'UTR was a gift from Marina Chekulaeva (Addgene plasmid # 118615 ; http://n2t.net/addgene:118615 ; RRID:Addgene_118615) -
For your References section:
Alternative 3' UTRs direct localization of functionally diverse protein isoforms in neuronal compartments. Ciolli Mattioli C, Rom A, Franke V, Imami K, Arrey G, Terne M, Woehler A, Akalin A, Ulitsky I, Chekulaeva M. Nucleic Acids Res. 2018 Dec 22. pii: 5258023. doi: 10.1093/nar/gky1270. 10.1093/nar/gky1270 PubMed 30590745