pMCh2007_pLenti_Syn_mChe-cdc42E7
(Plasmid
#118620)
-
Purposeexpression of mChe-tagged cdc42E7 under pSyn promoter for primary neurons
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 118620 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLenti.Syn(0.5).H2B-eGFP.W
- Backbone size w/o insert (bp) 7846
- Total vector size (bp) 10790
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBleomycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namecdc42E7
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1983
-
Mutationchanged cagtctg to ggcataa (667 - 673 nt in 3'UTR) for shRNA resistance
-
GenBank IDNM_009861 NM_009861
-
Entrez GeneCdc42
- Promoter synapsin I (rat)
-
Tag
/ Fusion Protein
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCACCACAAGAGGTGCAAGATAG
- 3′ sequencing primer CAGGGAAGTAGCCTTGTGTGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMCh2007_pLenti_Syn_mChe-cdc42E7 was a gift from Marina Chekulaeva (Addgene plasmid # 118620 ; http://n2t.net/addgene:118620 ; RRID:Addgene_118620) -
For your References section:
Alternative 3' UTRs direct localization of functionally diverse protein isoforms in neuronal compartments. Ciolli Mattioli C, Rom A, Franke V, Imami K, Arrey G, Terne M, Woehler A, Akalin A, Ulitsky I, Chekulaeva M. Nucleic Acids Res. 2018 Dec 22. pii: 5258023. doi: 10.1093/nar/gky1270. 10.1093/nar/gky1270 PubMed 30590745