Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMCh2007_pLenti_Syn_mChe-cdc42E7
(Plasmid #118620)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 118620 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLenti.Syn(0.5).H2B-eGFP.W
  • Backbone size w/o insert (bp) 7846
  • Total vector size (bp) 10790
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Bleomycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    cdc42E7
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1983
  • Mutation
    changed cagtctg to ggcataa (667 - 673 nt in 3'UTR) for shRNA resistance
  • GenBank ID
    NM_009861 NM_009861
  • Entrez Gene
    Cdc42
  • Promoter synapsin I (rat)
  • Tag / Fusion Protein
    • mCherry (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCACCACAAGAGGTGCAAGATAG
  • 3′ sequencing primer CAGGGAAGTAGCCTTGTGTGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMCh2007_pLenti_Syn_mChe-cdc42E7 was a gift from Marina Chekulaeva (Addgene plasmid # 118620 ; http://n2t.net/addgene:118620 ; RRID:Addgene_118620)
  • For your References section:

    Alternative 3' UTRs direct localization of functionally diverse protein isoforms in neuronal compartments. Ciolli Mattioli C, Rom A, Franke V, Imami K, Arrey G, Terne M, Woehler A, Akalin A, Ulitsky I, Chekulaeva M. Nucleic Acids Res. 2018 Dec 22. pii: 5258023. doi: 10.1093/nar/gky1270. 10.1093/nar/gky1270 PubMed 30590745