Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

V5-ERG-R367K
(Plasmid #118624)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 118624 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    N106
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ERG (R367K DNA binding mutant)
  • Species
    H. sapiens (human)
  • Mutation
    R367K
  • GenBank ID
    NP_891548.1
  • Entrez Gene
    ERG (a.k.a. LMPHM14, erg-3, p55)
  • Promoter EF1a
  • Tag / Fusion Protein
    • V5 (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ggcacttgatgtaattctccttg
  • 3′ sequencing primer gtggatgtggaatgtgtgcga
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

V5 tagged TMPRSS2-ERG R367K (aa33-479) with 2aa linker between V5 and ERG

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    V5-ERG-R367K was a gift from William Hahn (Addgene plasmid # 118624 ; http://n2t.net/addgene:118624 ; RRID:Addgene_118624)
  • For your References section:

    Binding of TMPRSS2-ERG to BAF Chromatin Remodeling Complexes Mediates Prostate Oncogenesis. Sandoval GJ, Pulice JL, Pakula H, Schenone M, Takeda DY, Pop M, Boulay G, Williamson KE, McBride MJ, Pan J, St Pierre R, Hartman E, Garraway LA, Carr SA, Rivera MN, Li Z, Ronco L, Hahn WC, Kadoch C. Mol Cell. 2018 Aug 16;71(4):554-566.e7. doi: 10.1016/j.molcel.2018.06.040. Epub 2018 Aug 2. 10.1016/j.molcel.2018.06.040 PubMed 30078722