V5-ERG-R367K
(Plasmid
#118624)
-
PurposeExpresses V5 tagged ERG R367K (DNA binding mutant) protein
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 118624 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneN106
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameERG (R367K DNA binding mutant)
-
SpeciesH. sapiens (human)
-
MutationR367K
-
GenBank IDNP_891548.1
-
Entrez GeneERG (a.k.a. LMPHM14, erg-3, p55)
- Promoter EF1a
-
Tag
/ Fusion Protein
- V5 (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ggcacttgatgtaattctccttg
- 3′ sequencing primer gtggatgtggaatgtgtgcga (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
V5 tagged TMPRSS2-ERG R367K (aa33-479) with 2aa linker between V5 and ERG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
V5-ERG-R367K was a gift from William Hahn (Addgene plasmid # 118624 ; http://n2t.net/addgene:118624 ; RRID:Addgene_118624) -
For your References section:
Binding of TMPRSS2-ERG to BAF Chromatin Remodeling Complexes Mediates Prostate Oncogenesis. Sandoval GJ, Pulice JL, Pakula H, Schenone M, Takeda DY, Pop M, Boulay G, Williamson KE, McBride MJ, Pan J, St Pierre R, Hartman E, Garraway LA, Carr SA, Rivera MN, Li Z, Ronco L, Hahn WC, Kadoch C. Mol Cell. 2018 Aug 16;71(4):554-566.e7. doi: 10.1016/j.molcel.2018.06.040. Epub 2018 Aug 2. 10.1016/j.molcel.2018.06.040 PubMed 30078722