Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #118977)


Item Catalog # Description Quantity Price (USD)
Plasmid 118977 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    EMD Biosciences
  • Backbone size w/o insert (bp) 5443
  • Total vector size (bp) 5953
  • Modifications to backbone
    Part of the original backbone, containing the T7 promoter, the RBS and the T7 terminator, was replaced by the insert.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    adenylate kinase isoenzyme 1 AK1
  • Alt name
  • Species
    G. gallus (chicken)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
  • Promoter T7 promoter
  • Tag / Fusion Protein
    • 6x-His (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCGTCCCATTCGCCAATCCG
  • 3′ sequencing primer GCGTCCGGCGTAGAGGATC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Gene was originally clone to vector pET29b by Yoshihiro Shimizu, RIKEN Center for Biosystems Dynamics Research

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-21a(+)-AK1-His was a gift from Sebastian Maerkl (Addgene plasmid # 118977 ; ; RRID:Addgene_118977)
  • For your References section:

    A simple, robust, and low-cost method to produce the PURE cell-free system. Lavickova B, Maerkl SJ. ACS Synth Biol. 2019 Jan 11. doi: 10.1021/acssynbio.8b00427. 10.1021/acssynbio.8b00427 PubMed 30632751