pFGL1252_TetGFP(Hyg)
(Plasmid
#118993)
-
PurposeTetOFF controlled GFP-tagging vector with Hygromycin selection
-
Depositing Lab
-
Depositing OrganizationTemasek Life Sciences Laboratory
Located in Singapore -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 118993 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 118993-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 118993-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepFGL125_TetOFF(Hyg)
-
Backbone manufacturerNaweed Lab
- Backbone size w/o insert (bp) 10687
- Total vector size (bp) 11398
-
Modifications to backboneTet OFF cassette fused with eGFP (no stop codon)
-
Vector typeFungal expression (in Magnaporthe oryzae)
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameeGFP
-
SpeciesSynthetic
-
Insert Size (bp)723
- Promoter Ustilago maydis Mfa1 basal promoter with six tetO binding sites
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nde I (destroyed during cloning)
- 3′ cloning site Kpn I (not destroyed)
- 5′ sequencing primer GGTCATATGGTGAGCAAGGGCGAGGAG
- 3′ sequencing primer TAGGGTACCCTTGTACAGCTCGTCCATGCC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 118993-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 118993-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFGL1252_TetGFP(Hyg) was a gift from Naweed Naqvi (Addgene plasmid # 118993 ; http://n2t.net/addgene:118993 ; RRID:Addgene_118993) -
For your References section:
Cellular Dynamics and Genomic Identity of Centromeres in Cereal Blast Fungus. Yadav V, Yang F, Reza MH, Liu S, Valent B, Sanyal K, Naqvi NI. MBio. 2019 Jul 30;10(4). pii: mBio.01581-19. doi: 10.1128/mBio.01581-19. 10.1128/mBio.01581-19 PubMed 31363034