pFGL1259R
(Plasmid
#118995)
-
PurposemCherry (without start and stop codons) in pGFL1010
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 118995 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFGL1010
-
Backbone manufacturerNaweed Lab
- Backbone size w/o insert (bp) 10383
- Total vector size (bp) 11085
-
Modifications to backboneInsertion of mCherry (without start and stop codons)
-
Vector typeFungal expression
-
Selectable markersSulfonylurea (Chlorimuron ethyl)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry (without start and stop codons)
-
SpeciesSynthetic
-
Insert Size (bp)717
- Promoter promoter less
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Kpn I (not destroyed)
- 3′ cloning site BamH I (not destroyed)
- 5′ sequencing primer CTCGGTACCGTGAGCAAGGGCGAGGAGGATAA
- 3′ sequencing primer CGCGGATCCCTTGTACAGCTCGTCCATGCCGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFGL1259R was a gift from Naweed Naqvi (Addgene plasmid # 118995 ; http://n2t.net/addgene:118995 ; RRID:Addgene_118995) -
For your References section:
Cellular Dynamics and Genomic Identity of Centromeres in Cereal Blast Fungus. Yadav V, Yang F, Reza MH, Liu S, Valent B, Sanyal K, Naqvi NI. MBio. 2019 Jul 30;10(4). pii: mBio.01581-19. doi: 10.1128/mBio.01581-19. 10.1128/mBio.01581-19 PubMed 31363034