pCCLc-MND-B2705-KK10-SABR
(Plasmid
#119053)
-
Purpose3rd gen transfer vector. HLA-B2705 linked to b2-microglobulin and CD28-CD3z signaling domain. Contains the HIV(gag) KK10 epitope "KRWIILGLNK" cloned via BsmBI
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 119053 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCCLc-MND
-
Backbone manufacturerDonald B. Kohn's laboratory at UCLA
- Backbone size w/o insert (bp) 6600
- Total vector size (bp) 9000
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markerssurface myc-tag
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameB2705-KK10-SABR
- Promoter MND
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTCCCCGAGCTCAATAAAAG
- 3′ sequencing primer TGGCTAAGATCTACAGCTGCCTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCCLc-MND-B2705-KK10-SABR was a gift from David Baltimore (Addgene plasmid # 119053 ; http://n2t.net/addgene:119053 ; RRID:Addgene_119053) -
For your References section:
T cell antigen discovery via signaling and antigen-presenting bifunctional receptors. Joglekar AV, Leonard MT, Jeppson JD, Swift M, Li G, Wong S, Peng S, Zaretsky JM, Heath JR, Ribas A, Bethune MT & Baltimore D.. Nature Methods (2019) volume 16, pages 191–198. 10.1038/s41592-018-0304-8