A3Bi-Cas9n-UGI
(Plasmid
#119135)
-
PurposeBase editor made from full-length APOBEC3B with an L1 intron to prevent self-restriction
-
Depositing Lab
-
Depositing OrganizationUniversity of Minnesota
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 119135 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 119135-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 119135-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneBE3
-
Backbone manufacturerLiu Lab
- Backbone size w/o insert (bp) 7825
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAPOBEC3B L1 intron-Cas9 nickase-UGI
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1469
-
MutationL1 intron insertion
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site XmaI (not destroyed)
- 5′ sequencing primer CGTGTACGGTGGGAGGTCTA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 119135-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 119135-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
A3Bi-Cas9n-UGI was a gift from Reuben Harris (Addgene plasmid # 119135 ; http://n2t.net/addgene:119135 ; RRID:Addgene_119135) -
For your References section:
A panel of eGFP reporters for single base editing by APOBEC-Cas9 editosome complexes. Martin AS, Salamango DJ, Serebrenik AA, Shaban NM, Brown WL, Harris RS. Sci Rep. 2019 Jan 24;9(1):497. doi: 10.1038/s41598-018-36739-9. 10.1038/s41598-018-36739-9 PubMed 30679582
