Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

eGFP L138 gRNA
(Plasmid #119133)


Item Catalog # Description Quantity Price (USD)
Plasmid 119133 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Joung Lab
  • Backbone size w/o insert (bp) 2278
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
    eGFP L138 gRNA
  • gRNA/shRNA sequence
  • Insert Size (bp)
  • Mutation
  • Promoter U6

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TTTCTTGGGTAGTTTGCAGTTTT
  • 3′ sequencing primer CGGTGCCACTTTTTCAAGTT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    eGFP L138 gRNA was a gift from Reuben Harris (Addgene plasmid # 119133 ; ; RRID:Addgene_119133)
  • For your References section:

    A panel of eGFP reporters for single base editing by APOBEC-Cas9 editosome complexes. Martin AS, Salamango DJ, Serebrenik AA, Shaban NM, Brown WL, Harris RS. Sci Rep. 2019 Jan 24;9(1):497. doi: 10.1038/s41598-018-36739-9. 10.1038/s41598-018-36739-9 PubMed 30679582