pJKW1270
(Plasmid
#119172)
-
PurposeN.benthamiana expression plasmid for PmCYP719A26
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 119172 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEAQ-HT
- Backbone size w/o insert (bp) 10003
- Total vector size (bp) 11491
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePmCYP719A26
-
Alt namePmMTS1
-
SpeciesPiper methysticum
-
Insert Size (bp)1536
-
GenBank IDMK058499
- Promoter CaMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGGTTCTATAAGAAATCTAG
- 3′ sequencing primer ACACTCTGAGCACAGAAAAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJKW1270 was a gift from Jing-Ke Weng (Addgene plasmid # 119172) -
For your References section:
The biosynthetic origin of psychoactive kavalactones in kava. Pluskal T, Torrens-Spence MP, Fallon TR, De Abreu A, Shi CH, Weng JK. Nat Plants. 2019 Jul 22. pii: 10.1038/s41477-019-0474-0. doi: 10.1038/s41477-019-0474-0. 10.1038/s41477-019-0474-0 PubMed 31332312