pJKW1538
(Plasmid
#119175)
-
PurposeYeast expression plasmid for PmSPS1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 119175 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep426TEF
- Backbone size w/o insert (bp) 6352
- Total vector size (bp) 7552
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePmSPS1
-
SpeciesPiper methysticum
-
Insert Size (bp)1194
-
GenBank IDMK058493
- Promoter TEF1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TACTTCTTGCTCATTAGAAAGA
- 3′ sequencing primer tcgaggtcgacggtatcgataa
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJKW1538 was a gift from Jing-Ke Weng (Addgene plasmid # 119175 ; http://n2t.net/addgene:119175 ; RRID:Addgene_119175) -
For your References section:
The biosynthetic origin of psychoactive kavalactones in kava. Pluskal T, Torrens-Spence MP, Fallon TR, De Abreu A, Shi CH, Weng JK. Nat Plants. 2019 Jul 22. pii: 10.1038/s41477-019-0474-0. doi: 10.1038/s41477-019-0474-0. 10.1038/s41477-019-0474-0 PubMed 31332312