pAMP-CY1_NF1 T1 (+minintr, KDR)
(Plasmid
#119200)
-
Purposetransfer vector
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 119200 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAMP-CY1
-
Backbone manufacturerModified from pGEX-4T-1
- Backbone size w/o insert (bp) 2203
- Total vector size (bp) 10725
-
Vector typeTransfer vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsDH5a can also be used. Terrific Broth medium can be used to improve plasmid yield, but is not required.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNF1 type 1 mini-gene
-
Alt nameneurofibromin type 1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)8600
-
GenBank IDNM_000267.3, NP_000258.1 Entrez Gene ID: 4763
-
Entrez GeneNF1 (a.k.a. NFNS, VRNF, WSS)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer pMB1ori-seqF: agggggaaacgcctggtatc; hsNF1-seqR1: taactgctaactgcgcaacc
- 3′ sequencing primer hsNF1-seqF13: cagtgttgtgtttcccaaagtc; pGEX-seqR: cctgacgggcttgtctgctc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
See the attached comments. For proper annotations, see the attached gbk file; the sequence completely matches Addgene NGS results. Plasmid designed and cloned by Yan Cui, PhD
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAMP-CY1_NF1 T1 (+minintr, KDR) was a gift from Helen Morrison (Addgene plasmid # 119200 ; http://n2t.net/addgene:119200 ; RRID:Addgene_119200) -
For your References section:
Construction of cloning-friendly minigenes for mammalian expression of full-length human NF1 isoforms. Cui Y, Morrison H. Hum Mutat. 2018 Nov 8. doi: 10.1002/humu.23681. 10.1002/humu.23681 PubMed 30408279