Skip to main content
Addgene

pAMP-CY1_NF1 T1 (+minintr, KDR)
(Plasmid #119200)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119200 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAMP-CY1
  • Backbone manufacturer
    Modified from pGEX-4T-1
  • Backbone size w/o insert (bp) 2203
  • Total vector size (bp) 10725
  • Vector type
    Transfer vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    DH5a can also be used. Terrific Broth medium can be used to improve plasmid yield, but is not required.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    NF1 type 1 mini-gene
  • Alt name
    neurofibromin type 1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    8600
  • GenBank ID
    NM_000267.3, NP_000258.1 Entrez Gene ID: 4763
  • Entrez Gene
    NF1 (a.k.a. NFNS, VRNF, WSS)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer pMB1ori-seqF: agggggaaacgcctggtatc; hsNF1-seqR1: taactgctaactgcgcaacc
  • 3′ sequencing primer hsNF1-seqF13: cagtgttgtgtttcccaaagtc; pGEX-seqR: cctgacgggcttgtctgctc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

See the attached comments. For proper annotations, see the attached gbk file; the sequence completely matches Addgene NGS results. Plasmid designed and cloned by Yan Cui, PhD

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAMP-CY1_NF1 T1 (+minintr, KDR) was a gift from Helen Morrison (Addgene plasmid # 119200 ; http://n2t.net/addgene:119200 ; RRID:Addgene_119200)
  • For your References section:

    Construction of cloning-friendly minigenes for mammalian expression of full-length human NF1 isoforms. Cui Y, Morrison H. Hum Mutat. 2018 Nov 8. doi: 10.1002/humu.23681. 10.1002/humu.23681 PubMed 30408279