Skip to main content
Addgene

pLV-H1-SGIPZ_NF1 sh1miR
(Plasmid #119206)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 119206 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLV-H1-SGIPZ
  • Backbone manufacturer
    Modified from pGIPZ
  • Backbone size w/o insert (bp) 9359
  • Total vector size (bp) 9441
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Bleocin (Zeocin), 100 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    We usually don't use Zeocin for E. coli culture.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sh1miR targeting NF1
  • gRNA/shRNA sequence
    GCTGGCAGTTTCAAACGTAA
  • Species
    H. sapiens (human), M. musculus (mouse), R. norvegicus (rat)
  • Insert Size (bp)
    82
  • GenBank ID
  • Entrez Gene
    NF1 (a.k.a. NFNS, VRNF, WSS)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The miRNA may also target additional species.
The vector also expresses turboGFP.
The restriction sites useful for verifying the vector and distinguishing from the empty vector (Addgene #119217) are indicated on the map; we suggest using MluI+SalI or MluI+BsrGI. Plasmid designed and cloned by Yan Cui, PhD

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-H1-SGIPZ_NF1 sh1miR was a gift from Helen Morrison (Addgene plasmid # 119206 ; http://n2t.net/addgene:119206 ; RRID:Addgene_119206)
  • For your References section:

    Construction of cloning-friendly minigenes for mammalian expression of full-length human NF1 isoforms. Cui Y, Morrison H. Hum Mutat. 2018 Nov 8. doi: 10.1002/humu.23681. 10.1002/humu.23681 PubMed 30408279