-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 11932 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4731
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUbiquitin KO.G76V
-
Alt nameUbiquitin
-
Alt nameubiquitin
-
Alt nameUb
-
SpeciesH. sapiens (human)
-
Insert Size (bp)245
-
MutationConjugation deficient mutant. All 7 lysines of ubiquitin mutated to arginines. Glycine 76 mutated to valine.
-
Entrez GeneRBX1 (a.k.a. BA554C12.1, RNF75, ROC1)
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer EGFP-C (CATGGTCCTGCTGGAGTTCGTG)
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-Ub KO.G76V was a gift from Nico Dantuma (Addgene plasmid # 11932 ; http://n2t.net/addgene:11932 ; RRID:Addgene_11932) -
For your References section:
A dynamic ubiquitin equilibrium couples proteasomal activity to chromatin remodeling. Dantuma NP, Groothuis TA, Salomons FA, Neefjes J. J Cell Biol. 2006 Apr 10. 173(1):19-26. 10.1083/jcb.200510071 PubMed 16606690