Skip to main content

Ub-M-GFP
(Plasmid #11938)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 11938 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    EGFP-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3970
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ub-M-GFP
  • Alt name
    Ubiquitin
  • Alt name
    Ub
  • Insert Size (bp)
    990
  • Mutation
    Ubiquitin fused to N-terminus of GFP. Methionine at position 1 between Ub and GFP. Stable version.

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer EGFP-N (CGTCGCCGTCCAGCTCGACCAG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The ubiquitin open reading frame was amplified by PCR from the Ub-Pro-Gal plasmid with the sense primer 5'-GCG GAATTCACCATGCAGATCTTCGTGAAGACT-3' and the antisense primer 5'-GCG GGATCCTGTCGACCAAGCTTCCCXXX
CCCACCTCTGAGACGGAGTAC-3' where the XXX leads to a Methionine at position 1 (see article Figure 1). The PCR product was cloned into the EcoRI and BamHI sites of the EGFP-N1 vector from Clontech.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Ub-M-GFP was a gift from Nico Dantuma (Addgene plasmid # 11938 ; http://n2t.net/addgene:11938 ; RRID:Addgene_11938)
  • For your References section:

    Short-lived green fluorescent proteins for quantifying ubiquitin/proteasome-dependent proteolysis in living cells. Dantuma NP, Lindsten K, Glas R, Jellne M, Masucci MG. Nat Biotechnol. 2000 May . 18(5):538-43. 10.1038/75406 PubMed 10802622