FB005
(Plasmid
#119678)
-
PurposeCoding sequence nptII from E. coli domesticated into pUPD2 with AATG/GCTT barcodes. According to FungalBraid/GoldenBraid modular DNA assembly for A. tumefaciens-mediated genetic transformation
-
Depositing Lab
-
Depositing OrganizationAgencia Estatal Consejo Superior de Investigaciones Científicas, M.P.
Located in Spain -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 119678 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepUPD2 (Addgene #68161)
-
Backbone manufacturerDiego Orzaez
- Backbone size w/o insert (bp) 2690
- Total vector size (bp) 2901
-
Vector typeSynthetic Biology ; Domestication of DNA parts for GoldenBraid asembly
-
Selectable markersGeneticin
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegeneticin resistance marker
-
Alt namenptII
-
SpeciesEschericha coli
-
Insert Size (bp)795
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmB1 (destroyed during cloning)
- 3′ cloning site BsmB1 (destroyed during cloning)
- 5′ sequencing primer GCTTTCGCTAAGGATGATTTCTGG
- 3′ sequencing primer CAGGGTGGTGACACCTTGCC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FB005 was a gift from Jose Marcos (Addgene plasmid # 119678 ; http://n2t.net/addgene:119678 ; RRID:Addgene_119678) -
For your References section:
FungalBraid: A GoldenBraid-based modular cloning platform for the assembly and exchange of DNA elements tailored to fungal synthetic biology. Hernanz-Koers M, Gandia M, Garrigues S, Manzanares P, Yenush L, Orzaez D, Marcos JF. Fungal Genet Biol. 2018 Jul;116:51-61. doi: 10.1016/j.fgb.2018.04.010. Epub 2018 Apr 20. 10.1016/j.fgb.2018.04.010 PubMed 29680684