FB013
(Plasmid
#119710)
-
PurposeTU of the HSVtk negative marker for F2dU domesticated into pUPD2 with GGAG/TACT barcodes (reverse orientation). Used for gene KO with dual selec. According to FungalBraid modular DNA assembly for ATMT
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 119710 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUPD2 (Addgene #68161)
-
Backbone manufacturerDiego Orzaez
- Backbone size w/o insert (bp) 2690
- Total vector size (bp) 3891
-
Vector typeSynthetic Biology ; Domestication of DNA parts for GoldenBraid asembly
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNegative selection marker HSVtk (Pgpda:HSVtk:Ttub)
-
Alt nameHSVtk
-
SpeciesCochliobolus heterostrophus (Pgpda), Herpes simplex virus (HSVtk), Neurospora crassa (Ttub)
-
Insert Size (bp)1782
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmB1 (destroyed during cloning)
- 3′ cloning site BsmB1 (destroyed during cloning)
- 5′ sequencing primer GCTTTCGCTAAGGATGATTTCTGG
- 3′ sequencing primer CAGGGTGGTGACACCTTGCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FB013 was a gift from Jose Marcos (Addgene plasmid # 119710 ; http://n2t.net/addgene:119710 ; RRID:Addgene_119710) -
For your References section:
FungalBraid: A GoldenBraid-based modular cloning platform for the assembly and exchange of DNA elements tailored to fungal synthetic biology. Hernanz-Koers M, Gandia M, Garrigues S, Manzanares P, Yenush L, Orzaez D, Marcos JF. Fungal Genet Biol. 2018 Jul;116:51-61. doi: 10.1016/j.fgb.2018.04.010. Epub 2018 Apr 20. 10.1016/j.fgb.2018.04.010 PubMed 29680684