pLV312.3
(Plasmid
#119944)
-
PurposeExpresses C-terminal Npu DnaE Intein-SaKKH-BE3, tagRFP, and sgRNA in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 119944 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepx601
-
Backbone manufacturerFeng Zhang lab
- Backbone size w/o insert (bp) 4316
- Total vector size (bp) 6516
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameC-Intein (Npu DnaE) - C-terminal (740)SaKKH-BE3
-
Alt namesplit BE3 (C-terminus)
-
SpeciesR. norvegicus (rat); S. aureus
-
Insert Size (bp)3345
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (CMV for)
- 3′ sequencing primer CCTCGACTGTGCCTTCTA (bGH rev)
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bySaKKH-BE3 insert was cloned from pJL-SaKKH-BE3 (David Liu lab)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
sgRNA targets Pahenu2 mutation
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV312.3 was a gift from Gerald Schwank (Addgene plasmid # 119944 ; http://n2t.net/addgene:119944 ; RRID:Addgene_119944) -
For your References section:
Treatment of a metabolic liver disease by in vivo genome base editing in adult mice. Villiger L, Grisch-Chan HM, Lindsay H, Ringnalda F, Pogliano CB, Allegri G, Fingerhut R, Haberle J, Matos J, Robinson MD, Thony B, Schwank G. Nat Med. 2018 Oct;24(10):1519-1525. doi: 10.1038/s41591-018-0209-1. Epub 2018 Oct 8. 10.1038/s41591-018-0209-1 [pii] PubMed 30297904