Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRS313_ATP3T911A
(Plasmid #120254)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 120254 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRS313
  • Backbone size w/o insert (bp) 4967
  • Total vector size (bp) 6482
  • Vector type
    Yeast Expression
  • Selectable markers
    HIS3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ATP3
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    1516
  • Mutation
    T911 changed to A; Isoleucine 304 changed to Asparagine
  • GenBank ID
    NC_001134.8
  • Entrez Gene
    ATP3 (a.k.a. YBR039W)
  • Promoter ATP3

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CGCCAGGGTTTTCCCAGTCACGAC
  • 3′ sequencing primer ATTAACCCTCACTAAAGGGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRS313_ATP3T911A was a gift from Markus Ralser (Addgene plasmid # 120254 ; http://n2t.net/addgene:120254 ; RRID:Addgene_120254)
  • For your References section:

    The metabolic growth limitations of petite cells lacking the mitochondrial genome. Vowinckel J, Hartl J, Marx H, Kerick M, Runggatscher K, Keller MA, Mulleder M, Day J, Weber M, Rinnerthaler M, Yu JSL, Aulakh SK, Lehmann A, Mattanovich D, Timmermann B, Zhang N, Dunn CD, MacRae JI, Breitenbach M, Ralser M. Nat Metab. 2021 Nov;3(11):1521-1535. doi: 10.1038/s42255-021-00477-6. Epub 2021 Nov 18. 10.1038/s42255-021-00477-6 PubMed 34799698