pRS313_ATP3mut
(Plasmid
#120256)
-
PurposeExpression of ATP3-67 in yeast
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 120256 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRS313
- Backbone size w/o insert (bp) 4967
- Total vector size (bp) 6482
-
Vector typeYeast Expression
-
Selectable markersHIS3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameATP3
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1516
-
MutationIsoleucine 304 changed to Asparagine; Alanine 307 changed to Proline
-
GenBank IDNC_001134.8
-
Entrez GeneATP3 (a.k.a. YBR039W)
- Promoter ATP3
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CGCCAGGGTTTTCCCAGTCACGAC
- 3′ sequencing primer ATTAACCCTCACTAAAGGGA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRS313_ATP3mut was a gift from Markus Ralser (Addgene plasmid # 120256 ; http://n2t.net/addgene:120256 ; RRID:Addgene_120256) -
For your References section:
The metabolic growth limitations of petite cells lacking the mitochondrial genome. Vowinckel J, Hartl J, Marx H, Kerick M, Runggatscher K, Keller MA, Mulleder M, Day J, Weber M, Rinnerthaler M, Yu JSL, Aulakh SK, Lehmann A, Mattanovich D, Timmermann B, Zhang N, Dunn CD, MacRae JI, Breitenbach M, Ralser M. Nat Metab. 2021 Nov;3(11):1521-1535. doi: 10.1038/s42255-021-00477-6. Epub 2021 Nov 18. 10.1038/s42255-021-00477-6 PubMed 34799698