-
PurposeHelper plasmid for production of phagemid ssDNA, based on M13KO7
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 120346 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepsB4K5
-
Backbone manufacturerBioBrick registry
- Backbone size w/o insert (bp) 3200
- Total vector size (bp) 9449
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCoding part of the M13KO7 helper phage genome
-
SpeciesBacteriophage M13
-
Insert Size (bp)6270
- Promoter native phage promoters
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tgccacctgacgtctaagaa
- 3′ sequencing primer attaccgcctttgagtgagc (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HP17_KO7 was a gift from Hendrik Dietz (Addgene plasmid # 120346 ; http://n2t.net/addgene:120346 ; RRID:Addgene_120346) -
For your References section:
Biotechnological mass production of DNA origami. Praetorius F, Kick B, Behler KL, Honemann MN, Weuster-Botz D, Dietz H. Nature. 2017 Dec 6;552(7683):84-87. doi: 10.1038/nature24650. 10.1038/nature24650 PubMed 29219963