Skip to main content

HP17_KO7
(Plasmid #120346)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 120346 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    psB4K5
  • Backbone manufacturer
    BioBrick registry
  • Backbone size w/o insert (bp) 3200
  • Total vector size (bp) 9449
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Coding part of the M13KO7 helper phage genome
  • Species
    Bacteriophage M13
  • Insert Size (bp)
    6270
  • Promoter native phage promoters

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tgccacctgacgtctaagaa
  • 3′ sequencing primer attaccgcctttgagtgagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HP17_KO7 was a gift from Hendrik Dietz (Addgene plasmid # 120346 ; http://n2t.net/addgene:120346 ; RRID:Addgene_120346)
  • For your References section:

    Biotechnological mass production of DNA origami. Praetorius F, Kick B, Behler KL, Honemann MN, Weuster-Botz D, Dietz H. Nature. 2017 Dec 6;552(7683):84-87. doi: 10.1038/nature24650. 10.1038/nature24650 PubMed 29219963