Skip to main content

UL91-2xStrep pCDNA4
(Plasmid #120375)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 120375 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA4/TO
  • Backbone size w/o insert (bp) 6168
  • Total vector size (bp) 5456
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    UL91
  • Species
    Human Cytomegalovirus (HHV-5)
  • Insert Size (bp)
    333
  • GenBank ID
    3077494
  • Entrez Gene
    UL91 (a.k.a. HHV5wtgp084)
  • Promoter CMV
  • Tag / Fusion Protein
    • 2xStrep Tag II (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (destroyed during cloning)
  • 3′ cloning site NotI (destroyed during cloning)
  • 5′ sequencing primer cctccatagaagacaccgggac
  • 3′ sequencing primer aaggtgccactcccactgt
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    UL91-2xStrep pCDNA4 was a gift from Britt Glaunsinger (Addgene plasmid # 120375 ; http://n2t.net/addgene:120375 ; RRID:Addgene_120375)
  • For your References section:

    The interaction between ORF18 and ORF30 is required for late gene expression in Kaposi's sarcoma-associated herpesvirus. Castaneda AF, Glaunsinger BA. J Virol. 2018 Oct 10. pii: JVI.01488-18. doi: 10.1128/JVI.01488-18. 10.1128/JVI.01488-18 PubMed 30305361