Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

K8.1 Pr pGL4.16
(Plasmid #120377)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 120377 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGL4.16[luc2CP/Hygro]
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 6020
  • Total vector size (bp) 5998
  • Vector type
    Luciferase
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    K8.1 Promoter
  • Species
    Kaposi's sarcoma-associated herpesvirus (HHV-8)
  • Insert Size (bp)
    23
  • Promoter K8.1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ctagcaaaataggctgtccccagt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    K8.1 Pr pGL4.16 was a gift from Britt Glaunsinger (Addgene plasmid # 120377 ; http://n2t.net/addgene:120377 ; RRID:Addgene_120377)
  • For your References section:

    The interaction between ORF18 and ORF30 is required for late gene expression in Kaposi's sarcoma-associated herpesvirus. Castaneda AF, Glaunsinger BA. J Virol. 2018 Oct 10. pii: JVI.01488-18. doi: 10.1128/JVI.01488-18. 10.1128/JVI.01488-18 PubMed 30305361