-
Purposeover expression of sox11 using infection
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 120387 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti CMV GFP
- Backbone size w/o insert (bp) 7424
- Total vector size (bp) 8617
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesox11
-
Alt nameMus musculus SRY (sex determining region Y)-box 11
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1193
-
GenBank IDNM_009234.6
-
Entrez GeneSox11 (a.k.a. 1110038H03Rik, 6230403H02Rik, end1)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer CCCCATTGACGCAAATGGGCGG
- 3′ sequencing primer AAGTCGTGCTGCTTCATGTG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-CMV-GFP-Sox11 was a gift from Igor Ulitsky (Addgene plasmid # 120387 ; http://n2t.net/addgene:120387 ; RRID:Addgene_120387) -
For your References section:
Regulation of Neuroregeneration by Long Noncoding RNAs. Perry RB, Hezroni H, Goldrich MJ, Ulitsky I. Mol Cell. 2018 Nov 1;72(3):553-567.e5. doi: 10.1016/j.molcel.2018.09.021. Epub 2018 Oct 25. 10.1016/j.molcel.2018.09.021 PubMed 30401432