Skip to main content

pLenti-CMV-GFP-Sox11
(Plasmid #120387)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 120387 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti CMV GFP
  • Backbone size w/o insert (bp) 7424
  • Total vector size (bp) 8617
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sox11
  • Alt name
    Mus musculus SRY (sex determining region Y)-box 11
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1193
  • GenBank ID
    NM_009234.6
  • Entrez Gene
    Sox11 (a.k.a. 1110038H03Rik, 6230403H02Rik, AI836553, end, end1)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer CCCCATTGACGCAAATGGGCGG
  • 3′ sequencing primer AAGTCGTGCTGCTTCATGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-CMV-GFP-Sox11 was a gift from Igor Ulitsky (Addgene plasmid # 120387 ; http://n2t.net/addgene:120387 ; RRID:Addgene_120387)
  • For your References section:

    Regulation of Neuroregeneration by Long Noncoding RNAs. Perry RB, Hezroni H, Goldrich MJ, Ulitsky I. Mol Cell. 2018 Nov 1;72(3):553-567.e5. doi: 10.1016/j.molcel.2018.09.021. Epub 2018 Oct 25. 10.1016/j.molcel.2018.09.021 PubMed 30401432