Skip to main content

pAAV-U6-Diras2_1-hSyn::mCherry.3xFLAG-WPRE
(Plasmid #120393)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 120393 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 5718
  • Vector type
    AAV, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Diras2 shRNA
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    53
  • GenBank ID
    NM_001024474
  • Entrez Gene
    Diras2 (a.k.a. 2900052J15Rik, AI414999)
  • Promoter U6
  • Tags / Fusion Proteins
    • mCherry.3XFLAG (C terminal on backbone)
    • mCherry.3XFLAG (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BspQI (destroyed during cloning)
  • 3′ cloning site BspQI (destroyed during cloning)
  • 5′ sequencing primer GCCAACTCCATCACTAGGGG
  • 3′ sequencing primer ATGCGCAATTTGGGGAATGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The original backbone was published in Candemir et al. Eur Neuropsychopharmacol. 2016 (PMID: 26861996)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-U6-Diras2_1-hSyn::mCherry.3xFLAG-WPRE was a gift from Florian Freudenberg (Addgene plasmid # 120393 ; http://n2t.net/addgene:120393 ; RRID:Addgene_120393)
  • For your References section:

    Knockdown of the ADHD Candidate Gene Diras2 in Murine Hippocampal Primary Cells. Grunewald L, Chiocchetti AG, Weber H, Scholz CJ, Schartner C, Freudenberg F, Reif A. J Atten Disord. 2019 Jan 9:1087054718822129. doi: 10.1177/1087054718822129. 10.1177/1087054718822129 PubMed 30623719