pAAV-U6-Diras2_2-hSyn::mCherry.3xFLAG-WPRE
(Plasmid
#120394)
-
PurposepAAV plasmid expressing Diras2 shRNA2 under the U6 promoter and mCherry.3XFLAG under the hSyn promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 120394 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 5718
-
Vector typeAAV, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDiras2 shRNA
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)53
-
GenBank IDNM_001024474
-
Entrez GeneDiras2 (a.k.a. 2900052J15Rik, AI414999)
- Promoter U6
-
Tags
/ Fusion Proteins
- mCherry.3XFLAG (C terminal on backbone)
- mCherry.3XFLAG (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BspQI (destroyed during cloning)
- 3′ cloning site BspQI (destroyed during cloning)
- 5′ sequencing primer GCCAACTCCATCACTAGGGG
- 3′ sequencing primer ATGCGCAATTTGGGGAATGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The original backbone was published in Candemir et al. Eur Neuropsychopharmacol. 2016 (PMID: 26861996)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-U6-Diras2_2-hSyn::mCherry.3xFLAG-WPRE was a gift from Florian Freudenberg (Addgene plasmid # 120394 ; http://n2t.net/addgene:120394 ; RRID:Addgene_120394) -
For your References section:
Knockdown of the ADHD Candidate Gene Diras2 in Murine Hippocampal Primary Cells. Grunewald L, Chiocchetti AG, Weber H, Scholz CJ, Schartner C, Freudenberg F, Reif A. J Atten Disord. 2019 Jan 9:1087054718822129. doi: 10.1177/1087054718822129. 10.1177/1087054718822129 PubMed 30623719