Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-U6-Scrambled-hSyn::mCherry.3xFLAG-WPRE
(Plasmid #120395)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 120395 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 5718
  • Vector type
    AAV, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Scrambled shRNA
  • Insert Size (bp)
    53
  • GenBank ID
  • Promoter U6
  • Tags / Fusion Proteins
    • mCherry.3XFLAG (C terminal on backbone)
    • mCherry.3XFLAG (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BspQI (destroyed during cloning)
  • 3′ cloning site BspQI (destroyed during cloning)
  • 5′ sequencing primer GCCAACTCCATCACTAGGGG
  • 3′ sequencing primer ATGCGCAATTTGGGGAATGG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The original backbone was published in Candemir et al. Eur Neuropsychopharmacol. 2016 (PMID: 26861996)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-U6-Scrambled-hSyn::mCherry.3xFLAG-WPRE was a gift from Florian Freudenberg (Addgene plasmid # 120395 ; http://n2t.net/addgene:120395 ; RRID:Addgene_120395)
  • For your References section:

    Knockdown of the ADHD Candidate Gene Diras2 in Murine Hippocampal Primary Cells. Grunewald L, Chiocchetti AG, Weber H, Scholz CJ, Schartner C, Freudenberg F, Reif A. J Atten Disord. 2019 Jan 9:1087054718822129. doi: 10.1177/1087054718822129. 10.1177/1087054718822129 PubMed 30623719