-
Purpose(Empty Backbone) pAAV plasmid with BspQI sites for insertion of target specific shRNAs in frame of the murine U6 promoter and co expressing mCherry.3XFLAG under the hSyn promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 120392 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
- Backbone size (bp) 4000
-
Vector typeAAV
- Promoter U6
-
Tag
/ Fusion Protein
- mCherry.3XFLAG (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GCCAACTCCATCACTAGGGG
- 3′ sequencing primer ATGCGCAATTTGGGGAATGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The original backbone was published in Candemir et al. Eur Neuropsychopharmacol. 2016 (PMID: 26861996)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-U6-hSyn::mCherry.3xFLAG-WPRE was a gift from Florian Freudenberg (Addgene plasmid # 120392 ; http://n2t.net/addgene:120392 ; RRID:Addgene_120392) -
For your References section:
Knockdown of the ADHD Candidate Gene Diras2 in Murine Hippocampal Primary Cells. Grunewald L, Chiocchetti AG, Weber H, Scholz CJ, Schartner C, Freudenberg F, Reif A. J Atten Disord. 2019 Jan 9:1087054718822129. doi: 10.1177/1087054718822129. 10.1177/1087054718822129 PubMed 30623719