Skip to main content

pLV-shKcnk13
(Plasmid #120721)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 120721 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLL3.7
  • Backbone manufacturer
    MIT
  • Backbone size w/o insert (bp) 7649
  • Total vector size (bp) 7700
  • Vector type
    Mammalian Expression, Lentiviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Kcnk13
  • gRNA/shRNA sequence
    GGAATAAGACACTGTTACACC
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Kcnk13 (a.k.a. BB085247, F730021E22Rik, Gm1570, Gm1685)
  • Promoter mouse U6
  • Tag / Fusion Protein
    • GFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HpaI (destroyed during cloning)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer U6
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-shKcnk13 was a gift from Amy Lasek (Addgene plasmid # 120721 ; http://n2t.net/addgene:120721 ; RRID:Addgene_120721)
  • For your References section:

    Ethanol acts on KCNK13 potassium channels in the ventral tegmental area to increase firing rate and modulate binge-like drinking. You C, Savarese A, Vandegrift BJ, He D, Pandey SC, Lasek AW, Brodie MS. Neuropharmacology. 2018 Oct 14;144:29-36. doi: 10.1016/j.neuropharm.2018.10.008. 10.1016/j.neuropharm.2018.10.008 PubMed 30332606