pLV-shKcnk13
(Plasmid
#120721)
-
PurposeExpresses GFP and an shRNA targeting Kcnk13 (in pLL3.7)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 120721 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLL3.7
-
Backbone manufacturerMIT
- Backbone size w/o insert (bp) 7649
- Total vector size (bp) 7700
-
Vector typeMammalian Expression, Lentiviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKcnk13
-
gRNA/shRNA sequenceGGAATAAGACACTGTTACACC
-
SpeciesM. musculus (mouse)
-
Entrez GeneKcnk13 (a.k.a. BB085247, F730021E22Rik, Gm1570, Gm1685)
- Promoter mouse U6
-
Tag
/ Fusion Protein
- GFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HpaI (destroyed during cloning)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer U6 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-shKcnk13 was a gift from Amy Lasek (Addgene plasmid # 120721 ; http://n2t.net/addgene:120721 ; RRID:Addgene_120721) -
For your References section:
Ethanol acts on KCNK13 potassium channels in the ventral tegmental area to increase firing rate and modulate binge-like drinking. You C, Savarese A, Vandegrift BJ, He D, Pandey SC, Lasek AW, Brodie MS. Neuropharmacology. 2018 Oct 14;144:29-36. doi: 10.1016/j.neuropharm.2018.10.008. 10.1016/j.neuropharm.2018.10.008 PubMed 30332606